-
Notifications
You must be signed in to change notification settings - Fork 13
Command line tool
A command-line interface is provided to check the features quickly.
$ curl -sSLO https://github.com/chrovis/cljam/releases/download/0.4.1/cljam
$ chmod +x cljamPlace cljam on your $PATH where your shell can find it (e.g. ~/bin).
Homebrew (Mac OS X):
$ brew install xcoo/formulae/cljamlein bin creates standalone console executable into target directory.
$ lein with-profile +1.8 binCopy the executable cljam somewhere in your $PATH (e.g. ~/bin).
cljam has various sub-commands similar to SAMtools. Use --help option to
print all sub-commands and their descriptions.
$ cljam --help
Usage: cljam {view,convert,normalize,sort,index,pileup,faidx,dict,level,version} ...
Options Default Desc
------- ------- ----
-h, --no-help, --help false Show help
Command Desc
------- ----
view Extract/print all or sub alignments in SAM or BAM format.
convert Convert SAM to BAM or BAM to SAM.
normalize Normalize references of alignments.
sort Sort alignments by leftmost coordinates.
index Index sorted alignment for fast random access.
pileup Generate pileup for the BAM file.
faidx Index reference sequence in the FASTA format.
dict Create a FASTA sequence dictionary file.
level Add level of alignments.
version Print version number.cljam [sub-command] --help shows help with each sub-command.
$ cljam view --help
Extract/print all or sub alignments in SAM or BAM format.
Usage: cljam view [--header] [-f FORMAT] <in.bam|sam>
Options:
--header Include header
-f, --format FORMAT auto Input file format <auto|sam|bam>
-h, --help Print helpview prints contents of SAM/BAM, which is equivalent of samtools view.
$ cljam view --header test-resources/sam/test.sam
@SQ SN:ref LN:45
@SQ SN:ref2 LN:40
r003 16 ref 29 30 6H5M * 0 0 TAGGC *
r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112
r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA *
r003 0 ref 9 30 5H6M * 0 0 AGCTAA *
x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ??????????????????????????
r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC *
r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT *
x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA ????????????????????
x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ?????????????????????
x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ?????????????????????????
x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ???????????????????????
x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ????????????????????????convert command converts SAM into BAM or BAM into SAM while keeping the contents.
$ cljam convert test-resources/sam/test.sam /tmp/test.converted.bam
$ cljam convert test-resources/bam/test.bam /tmp/test.converted.samnormalize normalizes reference names in SAM/BAM. For example, chr01 will be
replaced by chr1, and 11 by chr11.
$ cljam view --header test-resources/sam/normalize_before.sam
@SQ SN:chr01 LN:45
@SQ SN:11 LN:40
r003 16 chr01 29 30 6H5M * 0 0 TAGGC *
r001 163 chr01 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112
r002 0 chr01 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA *
r003 0 chr01 9 30 5H6M * 0 0 AGCTAA *
x3 0 11 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ??????????????????????????
r004 0 chr01 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC *
r001 83 chr01 37 30 9M = 7 -39 CAGCGCCAT *
x1 0 11 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA ????????????????????
x2 0 11 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ?????????????????????
x4 0 11 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ?????????????????????????
x6 0 11 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ???????????????????????
x5 0 11 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ????????????????????????
$ cljam normalize test-resources/sam/normalize_before.sam /tmp/normalized.sam
$ cljam view --header /tmp/normalized.sam
@SQ SN:chr1 LN:45
@SQ SN:chr11 LN:40
r003 16 chr1 29 30 6H5M * 0 0 TAGGC *
r001 163 chr1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112
r002 0 chr1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA *
r003 0 chr1 9 30 5H6M * 0 0 AGCTAA *
x3 0 chr11 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ??????????????????????????
r004 0 chr1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC *
r001 83 chr1 37 30 9M = 7 -39 CAGCGCCAT *
x1 0 chr11 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA ????????????????????
x2 0 chr11 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ?????????????????????
x4 0 chr11 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ?????????????????????????
x6 0 chr11 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ???????????????????????
x5 0 chr11 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ????????????????????????sort sorts alignments in SAM/BAM by leftmost coordinates or querynames.
$ cljam view test-resources/bam/test.bam
r003 16 ref 29 30 6H5M * 0 0 TAGGC *
r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112
r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA *
r003 0 ref 9 30 5H6M * 0 0 AGCTAA *
x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ??????????????????????????
r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC *
r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT *
x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA ????????????????????
x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ?????????????????????
x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ?????????????????????????
x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ???????????????????????
x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ????????????????????????
$ cljam sort test-resources/bam/test.bam /tmp/test.sorted.bam
$ cljam view /tmp/test.sorted.bam
r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112
r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA *
r003 0 ref 9 30 5H6M * 0 0 AGCTAA *
r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC *
r003 16 ref 29 30 6H5M * 0 0 TAGGC *
r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT *
x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA ????????????????????
x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ?????????????????????
x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ??????????????????????????
x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ?????????????????????????
x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ????????????????????????
x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ???????????????????????Supply -o queryname option to sort alignments by querynames.
$ cljam sort -o queryname test-resources/bam/test.bam /tmp/test.sorted2.bam
$ cljam view /tmp/test.sorted2.bam
r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT *
r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112
r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA *
r003 16 ref 29 30 6H5M * 0 0 TAGGC *
r003 0 ref 9 30 5H6M * 0 0 AGCTAA *
r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC *
x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA ????????????????????
x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ?????????????????????
x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ??????????????????????????
x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ?????????????????????????
x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ????????????????????????
x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ???????????????????????index creates a BAM index (.bai) for fast random access. An input BAM must be sorted beforehand.
$ cp test-resources/bam/test.sorted.bam /tmp/
$ cljam index /tmp/test.sorted.bampileup generates pileup for a BAM, which is equivalent of samtools mpileup. An input BAM must be sorted and indexed beforehand.
$ cljam pileup test-resources/bam/test.sorted.bam
ref 7 N 1 T ~
ref 8 N 1 T ~
ref 9 N 3 AAA ~~~
ref 10 N 3 GGG ~~~
ref 11 N 3 AAC ~~~
ref 12 N 3 TTT ~~~
ref 13 N 3 AAA ~~~
ref 14 N 3 A+4AGAGA+2GGA ~~~
ref 15 N 2 GG ~~
...faidx creates a FASTA index (.fai) for fast random access.
$ cp test-resources/fasta/test.fa /tmp/
$ cljam faidx /tmp/test.fadict creates a FASTA sequence dictionary (.dict).
$ cljam dict test-resources/fasta/test.fa /tmp/test.dictlevel adds level of alignments to BAM.
$ cljam level test-resources/bam/test.sorted.bam /tmp/leveled.bam
$ cljam view /tmp/leveled.bam
r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * LV:i:0 XX:B:S,12561,2,20,112
r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * LV:i:1
r003 0 ref 9 30 5H6M * 0 0 AGCTAA * LV:i:2
r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * LV:i:2
r003 16 ref 29 30 6H5M * 0 0 TAGGC * LV:i:0
r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT * LV:i:0
x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA ???????????????????? LV:i:0
x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? LV:i:1
x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? LV:i:2
x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? LV:i:3
x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? LV:i:4
x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? LV:i:5LV:i:5 is a level field in the above result.
version prints the version of cljam.
$ cljam version
0.4.0